Sequence
                ATGAGACTGATCCCCCTGACTACCGCTGAACAGGTCGGCAAATGGGCTGCTCGCCATATCGTCAATCGTATCAATGCGTTCAAACCGACTGCCGATCGTCCGTTTGTACTGGGCCTGCCGACTGGCGGCACGCCGATGACCACCTATAAAGCGTTAGTCGAAATGCATAAAGCAGGCCAGGTCAGCTTTAAGCACGTTGTCACCTTCAACATGGACGAATATGTCGGTCTGCCGAAAGAGCATCCGGAAAGCTACTACAGCTTTATGCACCGTAATTTCTTCGATCACGTTGATATTCCAGCAGAAAACATCAACCTTCTCAACGGCAACGCCCCGGATATCGACGCCGAGTGCCGCCAGTATGAAGAAAAAATCCGTTCTTACGGAAAAATTCATCTGTTTATGGGCGGTGTAGGTAACGACGGTCATATTGCATTTAACGAACCGGCGTCTTCTCTGGCTTCTCGTACTCGTATCAAAACCCTGACTCATGACACTCGCGTCGCAAACTCTCGTTTCTTTGATAACGATGTTAATCAGGTGCCAAAATATGCCCTGACTGTCGGTGTTGGTACACTGCTGGATGCCGAAGAAGTGATGATTCTGGTGCTGGGTAGCCAGAAAGCACTGGCGCTGCAGGCCGCCGTTGAAGGTTGCGTGAACCATATGTGGACCATCAGCTGTCTGCAACTGCATCCGAAAGCGATCATGGTGTGCGATGAACCTTCCACCATGGAGCTGAAAGTTAAGACTTTAAGATATTTCAATGAATTAGAAGCAGAAAATATCAAAGGTCTGTAA
            

The nagB gene encodes glucosamine-6-phosphate deaminase, an enzyme that catalyzes the catabolic deamination of glucosamine-6-phosphate into fructose-6-phosphate. It is situated within the nag regulon, which also comprises the nagA, nagC, nagD, and nagE genes, coordinating the uptake, transport, and degradation of amino sugars [220].
Inactivation or deletion of the nagB gene is a key genetic engineering strategy employed to prevent the degradation of amino sugar intermediates. Blocking the glucosamine-6-phosphate deaminase activity prevents the conversion of glucosamine-6-phosphate into fructose-6-phosphate, thereby conserving the precursor pool and channeling metabolic flux toward the high-yield production of target amino sugars, such as glucosamine and N-acetylglucosamine [220].

Gene size:
Protein size:
Reactions R928
Compounds affected N-acetyl-β-D-glucosamine and D-glucosamine

Databases
EraGene: 2111465
KEGG: eco:b0678