Sequence
                ATGTTTTCTTTTTTCCTTGAAAATCAAACAATAACGGATACGCTTCAGACTTACATACAGAGAAAGTTATCTCCGCTGGGTAGTCCGGATTACGCTTACACTGTTGTGAGCAAAAAAAATCCTTCAAATGTTCTGATTATTTCCAGTTATCCTGACGAATGGATTAGGTTATACCGCGCTAACAACTTTCAGCTGACCGATCCGGTTATTCTCACGGCCTTTAAACGCACCTCGCCGTTTGCCTGGGATGAGAATATTACGCTGATGTCCGACCTGCGGTTCACCAAAATTTTCTCTTTATCCAAGCAATACAACATCGTTAACGGCTTTACCTATGTCCTGCATGACCACATGAACAACCTTGCTCTGTTGTCCGTGATCATTAAAGGCAACGATCAGACTGCGCTGGAGCAACGCCTTGCTGCCGAACAGGGCACGATGCAGATGCTGCTGATTGATTTTAACGAGCAGATGTACCGCCTGGCCGGTACCGAAGGCGAGCGAGCCCCGGCGTTAAATCAGAGCGCGGACAAAACGATATTTTCCTCGCGTGAAAATGAGGTGTTGTACTGGGCGAGTATGGGCAAAACCTATGCTGAGATTGCCGCTATTACGGGCATTTCTGTGAGTACCGTGAAGTTTCACATCAAGAATGTGGTCGTGAAACTGGGCGTCAGTAACGCCCGACAGGCTATCAGACTGGGTGTAGAACTGGATCTTATCAGACCGGCAGCGTCAGCGGCCAGGTAG
            

The esaI–esaR genes constitute a quorum-sensing (QS) regulatory module originally derived from Pantoea stewartii.
The esaI gene encodes a 3-oxohexanoyl-homoserine lactone (AHL) synthase, which produces the signaling molecule AHL. As fermentation proceeds, AHL gradually accumulates in a growth-dependent manner. The esaR gene encodes a LuxR-type transcriptional regulator that binds to the native PeaS promoter and activates transcription in the absence of AHL. When AHL concentration increases, it binds to EsaR and induces a conformational change that causes EsaR to dissociate from PeaS, thereby repressing transcription [212].
In summary, PeaS-driven expression is maximal at the beginning of fermentation, when AHL levels are low, and decreases progressively as AHL accumulates, establishing a dynamic, self-regulated transcriptional control of the genes under PeaS regulation.

Gene size:
Protein size:

Databases
EraGene: 2197610