cipA

Photorhabdus luminescens

Sequence
                atgattaatgacatgcatccttctttaattaaagataaagatatagtagatgacgtaatgctacgtagctgtaaaatcattgcaatgaaagttatgccagacaaagttatgcaagttatggtgactgtattaatgcatgatggcgtatgtgaagaaatgcttttgaaatggaatctgctagacaatagaggcatggcgatttataaagttctgatggaagcgctttgcgctaagaaagatgtgaaaattagcaccgtaggaaaagtaggtcctctcggctgcgattacattaattgcgtagaaatctctatgtaa

CipA is a large modular cell-surface adhesin from Photorhabdus luminescens anchored in the outer membrane. Its elongated architecture enables it to function as a structural scaffold presenting multiple binding interfaces for partner proteins, including CipB. The CipA–CipB pair can be repurposed in metabolic engineering as a scaffold–ligand system to organize sequential enzymes in close proximity, creating a channel-like arrangement that promotes efficient transfer of intermediates between consecutive catalytic steps. By forming physically independent complexes, CipA facilitates enzymatic intermediate channeling by reducing spatial distances between enzymes. When fused to target enzymes such as SmPRS or TktA, it enhances metabolic flux without requiring fixed binding stoichiometry and can self-assemble into protein crystalline inclusions in E. coli [340].

Gene size:
Protein size:
Compounds affected L-histidine

Databases
EraGene: 2197877
KEGG: plu:plu1576