Sequence
                ATGGCCACCGCGGTGAGGGTAATCACCAAGTGGGGCCACCCCACCGCGGACATCACCCACCTCGTTGTCTCCACTAACGCCGGCGCCCACTCCCTTGGGACCGACGAGTGGCTCGCGGCACTCCTCGGCCTCCGTGCCACCGTCCAACGCACCATCCTCTACATGCACGGCTGCTCCGCCAGCTGCAGCGCGCTTCGCCTCACCAAGGACATCGCCGAGAACAACCACGGGGCGCGCGTGCTCGTGGCCTGCACGGAGGTCTTCCTCATAGTGTTCGCCGCCCCCGACAAGGCCCACCTTGACACCCTCGTCACGCATTGCCATTTGTGTAATGCTGTTAACTACAAACCTGACTGA
            

CUS encodes curcuminoid synthase, a homodimeric type III polyketide synthase with the largest active-site cavity among type III PKSs. It catalyzes the condensation of feruloyl-CoA and malonyl-CoA to form a diketide-CoA intermediate, which is hydrolyzed to a β-keto acid and subsequently undergoes a second decarboxylative condensation with another feruloyl-CoA to yield curcumin. CUS is the rate-limiting enzyme in the curcumin biosynthetic pathway, and both its expression level and catalytic performance have been improved through directed evolution. It has been reported that disruption of a stem–loop structure within the 5′ region of the mRNA, encoding the first 14 amino acids, leads to enhanced protein expression, indicating that the native 5′ mRNA secondary structure of the wild-type enzyme is excessively stable and restricts efficient translation initiation. Consistently, evolved variants such as the M1 mutant, which carries substitutions including A10T, exhibit reduced stability of this 5′ mRNA structure, resulting in increased CUS expression and, consequently, elevated curcumin production [349].

Gene size:
Protein size:
Reactions R9434 and R11858
Compounds affected curcumin

Databases
EraGene: 2197914
NCBI RefSeq: XM_015783169.1