Sequence
                ATGAAAAACTGGAAAACAAGTGCAGAATCAATCCTGACCACCGGCCCGGTTGTACCGGTTATCGTGGTAAAAAAACTGGAACACGCGGTGCCGATGGCAAAAGCGTTGGTTGCTGGTGGGGTGCGCGTTCTGGAAGTGACTCTGCGTACCGAGTGTGCAGTTGACGCTATCCGTGCTATCGCCAAAGAAGTGCCTGAAGCGATTGTGGGTGCCGGTACGGTGCTGAATCCACAGCAGCTGGCAGAAGTCACTGAAGCGGGTGCACAGTTCGCAATTAGCCCGGGTCTGACCGAGCCGCTGCTGAAAGCTGCTACCGAAGGGACTATTCCTCTGATTCCGGGGATCAGCACTGTTTCCGAACTGATGCTGGGTATGGACTACGGTTTGAAAGAGTTCAAATTCTTCCCGGCTGAAGCTAACGGCGGCGTGAAAGCCCTGCAGGCGATCGCGGGTCCGTTCTCCCAGGTCCGTTTCTGCCCGACGGGTGGTATTTCTCCGGCTAACTACCGTGACTACCTGGCGCTGAAAAGCGTGCTGTGCATCGGTGGTTCCTGGCTGGTTCCGGCAGATGCGCTGGAAGCGGGCGATTACGACCGCATTACTAAGCTGGCGCGTGAAGCTGTAGAAGGCGCTAAGCTGTAA
            

The eda gene encodes 2-keto-3-deoxy-6-phosphogluconate (KDPG) aldolase, which cleaves KDPG into pyruvate and glyceraldehyde-3-phosphate. This reaction represents the final step of the Entner–Doudoroff (ED) pathway, one of the three main routes for glucose catabolism, alongside the Embden–Meyerhof–Parnas (EMP) and pentose phosphate (PP) pathways. The ED pathway channels carbon as pyruvate and glyceraldehyde-3-phosphate into the lower part of glycolysis, where they are further metabolized to generate energy. In this pathway, glucose is first oxidized to 6-phosphogluconate, which is then dehydrated by 6-phosphogluconate dehydratase (Edd) to produce KDPG, the substrate cleaved by KDPG aldolase [335]. Silencing the ED pathway has been observed to increase flux through the pentose phosphate pathway, particularly when the EMP pathway is attenuated, redirecting carbon toward NADPH generation and biosynthetic precursors [324].
Disruption of eda, particularly in combination with edd deletion, enhances riboflavin production by limiting competing carbon flux [345].

Gene size:
Protein size:
Reactions R1601 ,  R1263 and R1404
Compounds affected L-valine and riboflavin

Databases
EraGene: 2111377
KEGG: eco:b1850